marce51 marce51

13-02-2019
Physics

contestada

When water changes into vapor this is called?

Respuesta :

bushmichael422 bushmichael422

13-02-2019

When water changes into vapor, it is called evaporation. BONUS: This is formed by the boiling point of water, which is 230°F (Fahrenheit) or 110°C (Celsius).

Answer Link

Otras preguntas

hi asia hellooooo what are you doing

Please help me with this question on my homework (graded)

Identify the correct solution for -10+(-16)-10

Hernando ate 2/8 of a pizza for a dinner. He gave his 6 friends the rest of the pizza and told them to share it equally. To determine the fraction of the whole

Round the following to the highest place value and find the estimated product. 8 x 7342

Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t

Find the value of x in the equation without evaluating the power

If f(x) = |x|+ 9 and g(x) = -6, which describes the value of (f + g)(x)? O (f+g)(x) > 3 for all values of x O (f+ g)(x) < 3 for all values of x (f + g)(x)

I need help pls :) Nznsdhejj

Scientific explanations must always be based on ____