watermelon405 watermelon405

14-02-2019
Mathematics

contestada

The liquid volume of 1 juice box is about 150 ML. What is the liquid volume of 3 juice boxes

Respuesta :

help018 help018

14-02-2019

3 times 150 would be 450 so the answer would be 450 ML

Answer Link

Otras preguntas

This is my question please solve it thank you so much

Mauricio research on new products.

The map shows the population distribution of the United States. Population Distribution of the United States (2011) AK HI WA OR 8 NV ID MT WY UT CO AZ NM ND SD

how does palamedes try ulysses?

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated

A textbook store sold a combined total of 412 chemistry and math textbooks in a week. The number of chemistry textbooks sold was three times the number of math

I need some help with this I would really appreciate if you could help me with this.

V 5 Find the least common denominator (LCD) of 9 0 X and Ś 17/12

Liam's family has completed 40% of a trip. They have traveled 15 miles. How far is the trip?

Differentiate between physical and mechanical digestion, considering 4 or 5 points.