sergio9000 sergio9000

12-10-2020
Biology

contestada

Translate the following DNA sequence:
ATGCCATGGCATTGA

Respuesta :

chefchinoba2020 chefchinoba2020

12-10-2020

The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Answer Link

Otras preguntas

If you change the sign of a point’s x-coordinate from positive to negative, how will the location of the point change?

The density of red wine is 1.01g/cm3 and the density of olive oil is 0.92g/cm3.A salad dressing that consisted of these two ingredients was left sitting too lon

. In right triangle ABC, ?A = 90° and ?C is 18° less than twice the measure of ?B. What is the measure of ?B? A) 18° B) 36° C) 54° D) 72°

is. 8.250 greater. than. 8.25

Phil drove for 5 hours at 65 miles per hour. How far did he drive if d=rt?

What kind of density current is caused by a muddy, rapidly flowing mixture of sediment and water.

solve equation for k

What is the approximate solution to the equation 3t=29 ? 0.3263 3.0650 3.3672 9.6667 ASAP

If a particle spends 8 seconds in the air and travels 320 m forward and to a height of 64 m what is the horizontal velocity

Ninety two out of 138 students knew that lllinoid was nicknamed the prairie state about what fraction of the students knew the nickname