Ejaymes90 Ejaymes90

12-08-2021
Mathematics

contestada

I need help solving this please
1/8+2/3-11/12

Respuesta :

12-08-2021

-1/8 would be your answer

Answer Link

Otras preguntas

Arthropod characteristics include: segmented bodies, exoskeletons, head with eyes, and jointed ___.Question 4 options :appendages teeth toes wings brainly

√2x+6=-8 Please help!!

hlo is anyone there to talk with me??

What is the most interesting (and/or expensive) car you've seen before?

In a parallel line transversal one of your angles measures 36 degrees..

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated

Find the first 5 terms of the sequence.

What is the image of (-8,-12) after dilation by scale factor of 1/4 centered at the orgin

24 Type the correct answer in each box. Spell all words correctly. What type of maintenance does Riley perform? Riley identifies faults in software that has be

How do I do this question and I need answer please