NickTheKit
NickTheKit
13-01-2017
Mathematics
contestada
Please help! (picture)
Respuesta :
Аноним
Аноним
13-01-2017
the answer is .9 bc you have to add the negative numbers, which is 1.6 then subtract the result to the other number, 2.5
Answer Link
VER TODAS LAS RESPUESTAS ( 69+ )
Otras preguntas
a biased spinner can land on 1, 2, 3 or 4. The table shows the probabilities that the spinner will land on 2 and 4. The probability that the spinner will land o
1. What is the purpose of an intermediate crime scene photograph? to show a specific small detail to show crime scene entries and exits to show how old the vict
Write a letter to your friend telling him that you have climbed a mountain and you are thrilled and excited
Use £1 = 9.60 francs and £1 = 240 pesetas to work out how much 1 franc is in pesetas.
10. A 40 Kg crate (rubber chickens, perhaps?) is pulled across the ice with a rope. A force of 100 N is applied at an angle of 30 degrees with the horizontal to
Martin Luther King Jr. often spoke of a day in the future when he hoped that his children would be judged not by their skin color but instead by their character
To build a wall a bricklayer has to mix sand and cement in the ratio 4:1. a) How many shovels of sand would he need for two shovels of cement?
maybe some of the questions its asking
Please respond quickly, it's important
An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated
