zZgezz zZgezz
  • 10-09-2022
  • Mathematics
contestada

-9(-4)-6 find the value of expression

Respuesta :

Neoxr Neoxr
  • 10-09-2022

Answer:

30

Step-by-step explanation:

-9 × -4 = 36 (the two negatives cancel each other out)

36 - 6 = 30

Answer Link

Otras preguntas

The polynomial function p(x) = x^4 + 4x^3 -7x^2 - 22x +24 has known factors of (x +4 ) and (x-1 ) Rewrite p(x) as the product of linear factors Draw a rough s
Simplify the expression xy+x^2+2xy+y^2-3x^2
The ratio of a to b is 3:5. The difference between angle a and b is 36°. What is the size of angle C No links please it’s been bugging me for 30 minutes
Explain why the angle is important when launching projectile motion 
An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated
A+B=13 C/B=10 A+B+C=33 ABC?
What that shows 11/10-3/10​ I ready
Identify the slope and y-intercept of each linear function's equation. x-3=y -x + 3 = y y=1-3x y=3x-1 Intro slope = 3, y-intercept at -1 slope =-3, y-intercept
Does exposure to media affect adolescents? Why or why not
convert the following equation into slope intercept form. 2x - 4y = 8